The Stone Man by Luke Smitherd: An Analytical Review

COVER-TESTS2Contains some minor spoilers.

As I begin writing this review, I find myself teetering on a knife edge, uncertain as to which way I am going to fall (brilliant, you should go read this, or meh (indifference)). Let’s see what happens.

After having read The Martian last month, it was a toss up between two books that had been recommended to me: The Stone Man or The Name of the Wind. That 50/50 call went in favour of The Stone Man. I like sci-fi thrillers. I am writing one myself.

I read the free sample on my Kindle and three things stood out to me:

One. I think it is risky (read: too risky) to write dialogue early in your book with a lot of accent written in. In this case, a chav who is not a major player in the story. Yes, it gives the impression of authenticity, and this chav’s pronunciation of words was an accurate reflection, but unless it matters to the story you risk alienating your reader, forcing them to slow down, re-read some words and ultimately give them an excuse to stop. Doing that at the point where they haven’t yet committed to reading your whole story may cost you. I remember reading some advice along these lines in Dwight V Swain’s Techniques of the Selling Writer – the best book there is on how to write successfully. What’s that? Never heard of it? Do yourself a favour and go get a copy. Yes, I mean now. No, not in a minute. Now.

Two, I liked the main character, Andy. He was unstereotypically flawed.

Three, “GCCAATTGAATTTGGCCCGTTAACTCAGG”  – the Stone Man, when touched by a member of the public had caused that person to fall instantly into a semi-vegetative state where they rapidly fired off these letters over and over and of course, the letters represent DNA. You got me Luke, you got me. Here, quick, take my money.

Money paid, and full book downloaded to my Kindle, I continued on, intrigued as to why the Stone Man caused this to happen when he was touched. I also wanted to see more of what the main character Andy had to offer.

Suspense
The author does suspense really well. He has a remarkable ability to leave things up in the air, uncertain, unexplained, for a long time, but in a naturally written way (he isn’t spinning the pages out with flannel) and this just keeps you to turning those pages and staying up well past your bedtime. I think I read this book quicker than any other I have read this year and that is much to the author’s credit. I really can’t overstate how talented he is in this regard.

Characters
The main character, Andy, has Asperger’s, and the author really pulled that off well. Andy is also desperate for others to validate him, constantly trying to read other people’s behaviour, as well as assessing how others perceptive him. He is egotistical, yet aware he is at times manipulative and selfish — heartless even — but as the story progresses his character develops in a natural way; he looks back at his own behaviour and criticises his own intentions and actions.

The other characters work too; I thought Brigadier Straub was cold, calculating, and dangerous, yet as Andy often described her in the story: professional. And even minor characters were distinct. Early on, Andy ends up staying at a mate’s house and the interactions between the different characters (a husband and wife, and Andy) were really well delivered with undercurrents of marital disharmony and intellectual disparity, playing out under a backdrop of very unusual circumstances, combined with Andy’s ego and the perhaps-imagined sexual tension between himself and his mate’s wife. It is another thing the author does very well.

The author himself
After the story, the author provides a fairly lengthy ‘afterword’, and I have to say that he comes across as a really likeable guy. Genuine, and in love with what he’s doing. It’s clear that it really matters to him what readers think of his work and he wants to engage with them. He really wants his work to be appreciated, to be successful. And I get the impression that he deserves to be.

Mistakes
These don’t really add up to a major fail, but they’re worth talking about because they make interesting study topics and are areas where the book could be improved.

Typos.
I hate typos in books. I just think it shows a lack of quality and understanding of the craft of book writing. Typos can, and do, jar the reader and if there are too many then they go a step further and annoy the reader. I counted twenty-odd typos in this book (missing words/letters, duplicate words, wrong words), and that is simply too many. It doesn’t matter that it is self-published, because you are competing with traditionally published products. It is the same market regardless. Don’t get me wrong though, I have seen worse – much worse in fact. Raymond E Feist wrote A Crown Imperilled a few years ago and it contained a major continuity error. So bad that I still remember it years later. And he’s a veteran writer who has editors whose job it is to catch these errors. The point I am making though is that your book, that you wrote, is your product and one way or another it is down to you, the author, to make sure it is right. Can you really afford for it not to be perect? (see what I did there?? I can be a jerk sometimes, I apologise. Let’s move on.)

Failure to satisfy
I’m not worried about the ‘Where did the Stone Man come from?’ Or the ‘Who sent them?’ questions. These are things we should care about if such a thing were to happen in real life, but in this story it’s not pertinent, the character’s quite reasonably don’t know the answers and any reader asking these questions after reading the book probably doesn’t get storytelling.

But I do care about some other things that are pertinent. I paid my money to find out how and why the Stone Man was causing it’s victims to spout out (their? the stone man’s? someone else’s?) DNA. But I never got the answer. In fact it hardly even got discussed. And while we’re at it, why did the Stone Man appearing/disappearing cause the temperature to drop? They were compelling ideas but clearly needed to be developed further, else we’re heading into Lost territory…and we don’t want to go there again.

As a writer, I know what it’s like. You come up with a compelling idea, and subsequently need to explain the intricacies, make it all fit together, and deliver to your reader’s expectations. The answers are hard to come by because you have an original idea, it’s complex, and there is just you to work it out. But what you mustn’t do is settle for weak explanations, or worse, pretend it’s not something that needs dealing with and just skirt round it. Readers quite rightly hate this. When it comes to the story-telling part of being an author, this is what divides the good from the very good.

Killing off the wrong character
Note that I did not write, ‘Killing off the main character’. I have no problem with writers killing off the main character. It can absolutely be the right thing to do. But in this case, it wasn’t. The reason is that Andy was so much more interesting than Paul, the support character who the story then finished with. There are plenty of Pauls in other books you read. There are not so many Andys and although killing off the interesting character can have more impact, in this case I felt none (perhaps that was because of the way it was done?). But considering that the ending was a bit of an anticlimax by itself, things left hanging in a loop of uncertainty, Andy would have carried that type of ending much more effectively than Paul did.

Summary
This is not, therefore, a masterpiece. But, Luke Smitherd is close. These crimes are somewhat forgiveable because he delivers a lot of quality too and it’s clear that as a writer he poured himself into this book – neither of which I can say about Terry Brooks’ offering this year.

I set my standards high as a reader, and even more so as a writer. Top books make up a tiny portion of the whole; less than 1% (Yes, much less, but I’m making a point here so we’ll go with the round number). Everyone else sits in that 99% camp, and although I think this author is currently there too, I think he has one foot tentatively placed in that 1% territory. So “Mr 98 percent,” might be a fitting label at the moment. Being self-published, he has not had the benefit of an editor’s experience to guide him. I would be surprised if The Stone Man did not result in his landing a decent deal with one of the big publishing houses at which point I’ll be interested in his next work because they’ll help him refine his craft that tiny bit more.

So…Brilliant, or Meh? Should you go read it? Yes, for a few quid on your Kindle, it is a good purchase. You know, despite the few things I consider to be mistakes, I still really enjoyed the read and there is certainly more good about this book than there is bad and the part that is good, is very good. It’s head and shoulders above some of the offerings from more seasoned authors I have read this year and it’s better than Hugh Howey’s Sand (a self-published author who then landed a deal with Random House…his previous story, Wool, was awesome mind you). Chances are you’ll enjoy The Stone Man, and I think we’ll see really good things from Luke Smitherd in the future.

8/10.

Advertisements

One thought on “The Stone Man by Luke Smitherd: An Analytical Review

  1. I mostly agree with your review but think the where it came from and who sent them questions are just as fundamental as under standing the temperature drop and the spouting off of the genetic sequence. It is what had me hooked. Still an enjoyable story but unsatisfying at the end, as you say. Still, I look forward to reading more from this author.

    Liked by 1 person

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s