The Stone Man by Luke Smitherd: An Analytical Review

COVER-TESTS2Contains some minor spoilers.

As I begin writing this review, I find myself teetering on a knife edge, uncertain as to which way I am going to fall (brilliant, you should go read this, or meh (indifference)). Let’s see what happens.

After having read The Martian last month, it was a toss up between two books that had been recommended to me: The Stone Man or The Name of the Wind. That 50/50 call went in favour of The Stone Man. I like sci-fi thrillers. I am writing one myself.

I read the free sample on my Kindle and three things stood out to me:

One. I think it is risky (read: too risky) to write dialogue early in your book with a lot of accent written in. In this case, a chav who is not a major player in the story. Yes, it gives the impression of authenticity, and this chav’s pronunciation of words was an accurate reflection, but unless it matters to the story you risk alienating your reader, forcing them to slow down, re-read some words and ultimately give them an excuse to stop. Doing that at the point where they haven’t yet committed to reading your whole story may cost you. I remember reading some advice along these lines in Dwight V Swain’s Techniques of the Selling Writer – the best book there is on how to write successfully. What’s that? Never heard of it? Do yourself a favour and go get a copy. Yes, I mean now. No, not in a minute. Now.

Two, I liked the main character, Andy. He was unstereotypically flawed.

Three, “GCCAATTGAATTTGGCCCGTTAACTCAGG”  – the Stone Man, when touched by a member of the public had caused that person to fall instantly into a semi-vegetative state where they rapidly fired off these letters over and over and of course, the letters represent DNA. You got me Luke, you got me. Here, quick, take my money.

Money paid, and full book downloaded to my Kindle, I continued on, intrigued as to why the Stone Man caused this to happen when he was touched. I also wanted to see more of what the main character Andy had to offer.

Suspense
The author does suspense really well. He has a remarkable ability to leave things up in the air, uncertain, unexplained, for a long time, but in a naturally written way (he isn’t spinning the pages out with flannel) and this just keeps you to turning those pages and staying up well past your bedtime. I think I read this book quicker than any other I have read this year and that is much to the author’s credit. I really can’t overstate how talented he is in this regard.

Characters
The main character, Andy, has Asperger’s, and the author really pulled that off well. Andy is also desperate for others to validate him, constantly trying to read other people’s behaviour, as well as assessing how others perceptive him. He is egotistical, yet aware he is at times manipulative and selfish — heartless even — but as the story progresses his character develops in a natural way; he looks back at his own behaviour and criticises his own intentions and actions.

The other characters work too; I thought Brigadier Straub was cold, calculating, and dangerous, yet as Andy often described her in the story: professional. And even minor characters were distinct. Early on, Andy ends up staying at a mate’s house and the interactions between the different characters (a husband and wife, and Andy) were really well delivered with undercurrents of marital disharmony and intellectual disparity, playing out under a backdrop of very unusual circumstances, combined with Andy’s ego and the perhaps-imagined sexual tension between himself and his mate’s wife. It is another thing the author does very well.

The author himself
After the story, the author provides a fairly lengthy ‘afterword’, and I have to say that he comes across as a really likeable guy. Genuine, and in love with what he’s doing. It’s clear that it really matters to him what readers think of his work and he wants to engage with them. He really wants his work to be appreciated, to be successful. And I get the impression that he deserves to be.

Mistakes
These don’t really add up to a major fail, but they’re worth talking about because they make interesting study topics and are areas where the book could be improved.

Typos.
I hate typos in books. I just think it shows a lack of quality and understanding of the craft of book writing. Typos can, and do, jar the reader and if there are too many then they go a step further and annoy the reader. I counted twenty-odd typos in this book (missing words/letters, duplicate words, wrong words), and that is simply too many. It doesn’t matter that it is self-published, because you are competing with traditionally published products. It is the same market regardless. Don’t get me wrong though, I have seen worse – much worse in fact. Raymond E Feist wrote A Crown Imperilled a few years ago and it contained a major continuity error. So bad that I still remember it years later. And he’s a veteran writer who has editors whose job it is to catch these errors. The point I am making though is that your book, that you wrote, is your product and one way or another it is down to you, the author, to make sure it is right. Can you really afford for it not to be perect? (see what I did there?? I can be a jerk sometimes, I apologise. Let’s move on.)

Failure to satisfy
I’m not worried about the ‘Where did the Stone Man come from?’ Or the ‘Who sent them?’ questions. These are things we should care about if such a thing were to happen in real life, but in this story it’s not pertinent, the character’s quite reasonably don’t know the answers and any reader asking these questions after reading the book probably doesn’t get storytelling.

But I do care about some other things that are pertinent. I paid my money to find out how and why the Stone Man was causing it’s victims to spout out (their? the stone man’s? someone else’s?) DNA. But I never got the answer. In fact it hardly even got discussed. And while we’re at it, why did the Stone Man appearing/disappearing cause the temperature to drop? They were compelling ideas but clearly needed to be developed further, else we’re heading into Lost territory…and we don’t want to go there again.

As a writer, I know what it’s like. You come up with a compelling idea, and subsequently need to explain the intricacies, make it all fit together, and deliver to your reader’s expectations. The answers are hard to come by because you have an original idea, it’s complex, and there is just you to work it out. But what you mustn’t do is settle for weak explanations, or worse, pretend it’s not something that needs dealing with and just skirt round it. Readers quite rightly hate this. When it comes to the story-telling part of being an author, this is what divides the good from the very good.

Killing off the wrong character
Note that I did not write, ‘Killing off the main character’. I have no problem with writers killing off the main character. It can absolutely be the right thing to do. But in this case, it wasn’t. The reason is that Andy was so much more interesting than Paul, the support character who the story then finished with. There are plenty of Pauls in other books you read. There are not so many Andys and although killing off the interesting character can have more impact, in this case I felt none (perhaps that was because of the way it was done?). But considering that the ending was a bit of an anticlimax by itself, things left hanging in a loop of uncertainty, Andy would have carried that type of ending much more effectively than Paul did.

Summary
This is not, therefore, a masterpiece. But, Luke Smitherd is close. These crimes are somewhat forgiveable because he delivers a lot of quality too and it’s clear that as a writer he poured himself into this book – neither of which I can say about Terry Brooks’ offering this year.

I set my standards high as a reader, and even more so as a writer. Top books make up a tiny portion of the whole; less than 1% (Yes, much less, but I’m making a point here so we’ll go with the round number). Everyone else sits in that 99% camp, and although I think this author is currently there too, I think he has one foot tentatively placed in that 1% territory. So “Mr 98 percent,” might be a fitting label at the moment. Being self-published, he has not had the benefit of an editor’s experience to guide him. I would be surprised if The Stone Man did not result in his landing a decent deal with one of the big publishing houses at which point I’ll be interested in his next work because they’ll help him refine his craft that tiny bit more.

So…Brilliant, or Meh? Should you go read it? Yes, for a few quid on your Kindle, it is a good purchase. You know, despite the few things I consider to be mistakes, I still really enjoyed the read and there is certainly more good about this book than there is bad and the part that is good, is very good. It’s head and shoulders above some of the offerings from more seasoned authors I have read this year and it’s better than Hugh Howey’s Sand (a self-published author who then landed a deal with Random House…his previous story, Wool, was awesome mind you). Chances are you’ll enjoy The Stone Man, and I think we’ll see really good things from Luke Smitherd in the future.

8/10.

Advertisements

The Martian by Andy Weir: A review. Well, a full-on analysis if I’m being honest.

themartian

even the pic is cool

Let me just start by laying it out there: This is the best book I’ve read this year. You should go buy it.

Now with that out there, I can do my usual thing of analysing how this was written, try to get into the author’s head and understand what influenced him and why he wrote it the way he did. You can read about why this is my focus here.

There are some spoilers below, but it won’t spoil the read; it’ll be well worth you reading the book even if you read this review first.

The story follows Mark Watney, a stranded astronaut on Mars as he tries to survive and get rescued. For the most part, Mark’s situation is conveyed to us via his logbook and as such this is a bit different to the way a lot of books are told. Events are not in real time, they are told to you after having happened – but don’t worry, the author understands how to write it so that there is still suspense. A bad writer would have turned the book into an after-the-event retelling of a story, with no soul, but Andy Weir doesn’t do that.

Tension

The format provides certain advantages to the writer too and the author exploits them to the fullest. The fact the story is told as it is means that the author can set the reader up very easily. Take this example, the end of one log entry reads:

…Things are finally going my way. In fact, they’re going great! I have a chance to live after all!

Feeling pretty relaxed as a reader now, maybe even a hint of disappointment creeping in because of a lack of tension, right? Now read the next page:

LOG ENTRY: SOL 37

I am fucked, and I’m gonna die!

Now he’s really got your attention, you have felt what the character felt – you relaxed, got a bit complacent and it led to a mistake. A mistake that’s gonna kill you. Can you put the book down now? No. You cannot.  Andy Weir actually just make it physically impossible for your brain to fire the neurons required to make you close the book. This is just one example, and it’s without the surrounding context, but the author pulls tricks like this throughout the telling of this story and very soon you’ll be on the edge of your seat, not daring to get complacent again.

The author also sows seeds of doubt, gives little suggestions that the shit’s going to hit the fan, but without giving too much away. You really experience the doubt and uncertainty that Mark Watney goes through. As a NASA astronaut, he is obviously pretty mentally strong, as well as able and multi-skilled but you do start to see the cracks after a couple of Martian months and his task to survive grows much harder the longer he’s there.

Character and Humour

Andy Weir excels at humour, and creates an incredibly likeable, sarcastic character as the lead. This guy is alone on Mars, no company, no communications, no way to get home, and with only the resources he was left with. So of course, from a storytelling point of view, it is essential that you, the reader, like the main character. Here are some examples of the smart-ass at work (and you’ll notice Weir is exploiting the format again, too):

…Time to chow down and see what the good commander brought along for music.

LOG ENTRY: SOL 38 (2)

Disco. God damn it, Lewis.

And while reflecting on his being the man in control who gets to make all the decisions:

Actually, I was the very lowest ranked member of the crew. I would only be “in command” if I were the only remaining person.”
What do you know? I’m in command

And there are other gems, one liners such as “Everything went great right up to the explosion.” and “Like, melting-the-pigeons strong…” and my personal favourite:

It’s true, you know. In space, no one can hear you scream like a little girl.

Funny. And the whole book is littered with stuff that will make you chuckle. I guarantee it.

Of course, all these jokes work better when you aren’t expecting them, as opposed to how it reads here under the heading “Humour” but hopefully you see what I’m getting at. All this helps to give the main character, well…character.

But the other characters — back on earth and in space — although playing less significant roles, are each distinct and well chosen. They come across a little like some of the characters in a Michael Crighton book, perhaps needing a little more development, but I think this is because the main story is on Mars and these supporting characters rightly don’t get a lot of page time.

As someone who used to work with very technically minded, infuriatingly frustrating software developers who seem incapable of picking up on social cues, I can tell you that Andy Weir completely nails those characters that inhabit similar geek roles at NASA. And before anyone who’s read it screams that these are negative stereotypes that don’t represent reality – you’re wrong. You only have to look at the tool who wore that offensive shirt from the ESA’s Philae/Rosseta team recently on international media to realise that even more extreme stereotypes of such people really exist in real life. This scientist apologised. They aren’t really bad, honestly, they’re just very different (read: weird).

Bacteria!

Yes, it’s no secret to my readers that I’m a big fan of bacteria. So it was a nice bonus for me that the main character has botany skills and in attempting to grow food to survive, goes into some of the intricacies of soil bacteria. I’m also a big fan of growing veg, especially potatoes, so it was cool that potatoes were one of the few plants available to Mark Watney on Mars (I won’t go into why, read the book if you want to know why, there is a perfectly plausible explanation) – I do wonder though, whether Watney removed the flowers on the potato plants to divert all the energy to the tubers, or whether that is an unnecessary effort (opinion among vegetable growers always seems to be mixed). Being a botanist, I thought he might let me in on whether that’s really worth doing, or not.

Anyway — bacteria. Something I learnt then, was that bacteria when they are faced with a cold winter on Earth, don’t tend to survive, but come up from further underground where it is warmer and replace the dead ones. Who knew?

Science and Survival

But it’s not just bacteria that are cool. The story paints a pretty realistic picture of what it might be like to be stranded on Mars, having to make do with your limited resources and being forced to Jerry rig everything and take insane risks. We have Mark Watney attempting to turn hydrazine rocket fuel into water in the most dangerous and makeshift way imaginable as a result of these circumstances, and such attempts are very entertaining and would appeal to your average reader as well as those interested in their science and space survival.

Possible influences

My guess is that Andy Weir is a bit of a geek. He probably has a stacks of sci-fi movies and television-series on DVDs; the obvious ones like Star Wars and Gravity, but also the more obscure ones like Earth 2 (that was totally awesome, and should have got another series) and maybe even Primer. He no doubt has space-related programs on the Discovery Channel on series link and he’s hoping for a museum-quality replica NASA flight jacket for Christmas. He has a subscription to New Scientist which arrives through the mail, and he still has his Fisher-Price telescope in the attic from when he was a little boy, because he couldn’t bare to part with it. (Okay, that last bit was me). But in seriousness, he clearly either follows the detailed space program and the theories they come up with, or he researched them thoroughly for the book. Either way, I approve because he thoroughly understands his subject matter.

And I suspect he has watched Danny Boyle’s Sunshine and thought he could have done a better job by making it into a different kind of movie. And he’d be right. Talking of movies, 20th Century Fox bought the rights to the film and Ridley Scott is directing the movie in which Matt Damon will star as Mark Watney. It’s due for release in 2015 and is likely to be pretty awesome. Not bad for a story which started life, freely available on Andy Weir’s website a few years back.

I’d also bet that Andy Weir has a background in software development or a related field, the NASA science engineers in his book are too accurate to be by chance. I suppose, maybe, he actually worked at NASA…that would make a great deal of sense —— Nope, just checked on Wikipedia (which cannot lie) and he has a “background in computer science.” Awesome. I bet he wasn’t a test engineer though. The guy responsible for the safety checks and inspection of an all important NASA rocket is asked by the flight director how long he needs (they’re in a hurry to get supplies to Mark on Mars) he points out it takes 10 days. Under pressure he concedes that the inspections only find a critical fault about one in about forty launches and therefore agrees to cut them completely. Now, as someone who used to be responsible for Quality in a large software company, I can assure you that any engineer who was good enough to work for NASA would have pointed out that the rush job they were doing meant the risks were seriously amplified and would have argued for an extra ten days on top of the usual ten. But he didn’t, and you can guess that things don’t go smoothly. The guy responsible for the inspections almost killed Mark Watney. Anyway, I digress.

Style

As I’ve already said, the book is quite unconventional but the style is very easy to read and get along with and Weir is able to get across technical details without your needing a PhD to understand what’s going on. Even when we see the efforts on Earth to find a way to rescue their astronaut, and the style becomes more mainstream, it doesn’t jar the reader.

Does it lack anything?
A harsh critic might complain that the story lacks a villain. And it’s true, strictly speaking. Of course, you have to consider the type of story this is. It’s a story that could be true and it is about the human endeavour to explore, and to survive. Seeing it for what it is, you understand that Mars is the baddie in this story, and it’s a right bitch.

Given the point of the story, the climax is obviously Mark Watney’s ultimate survival and rescue from Mars. Just like in the Apollo 13 film, the climax is the fact they get home safe. The author understands that space exploration is ultimately a human attempt to understand and better ourselves even if that means it is dangerous, because we aim to overcome those obstacles, and that the attempt itself, along with how we respond as the human race when something goes wrong, perhaps represents the best of us. It was the right way to end the story.

I guess on a personal level that isn’t always my experience though. I do wish that it didn’t take a high profile space mishap to get humans demonstrating that they care about each other. I guess that’s what it takes to get through people’s apathy in life, to get them to take a second and watch, take in what is really going on and take a small action toward fixing the problem. Maybe then people would notice the 4 millionish people — including children — who suffer from ME/CFS, one of the most devastating diseases in the world, for which there is currently no treatment, and sadly, very little research aiming to correct this. There are many awful diseases out there, but is any which effects so many but has so little help? Please take a moment to check out some very promising research that patients are desperately trying to raise funds for, and think about contributing to help the many who are in real need of rescue right here on Earth: The Microbe Discovery Project.

Why I Review Books and Films (among other things)

Cookbook HelixThere are millions of reviewers out there, all typing out their opinion on whether a book or a movie is any good. And people want to read them because they are wondering if that book or that movie is in fact worth their time. The quality of these reviews differs greatly. But the questions, is it any good, and, what is it about? are what most of these reviewers are writing about.

But I’m not like these reviewers. I am not like them because I am reviewing for a different reason. So if you are reading for a different reason too, then you’re in the right place.

My reviews are short studies of how a story is told, how it is written and why the writer wrote it the way they did. I am doing this because I am an autodidact and I am teaching myself how to be the best writer I can be.

Do you want to know how good writers become great writers? They study. Hard. Some do it as part of a formal eduction. Some others do it without realizing they are doing it.  And some, like me, self-teach knowing full well what they are up to.

I read slowly. This year I will probably read more books than I have ever read in a single year. My target is only twelve. I read slowly because I am analysing. Sometimes I am analysing each and every word choice. But I basically pay attention to each granular level of the writing from single word up to whole book, the style, the structure, the unfolding of the story. And I am also looking at individual character paths and character development, the ebb and flow of the tension, emotion, mystery, what questions the reader is thinking and whether the writer intended this, or not…And this last one is perhaps most important, because I try to get inside the head of the author. Why does he make the choices that he makes? What influences him? Can he get inside his reader’s head? Where did his ideas come from? What went through his mind?

Because if the writer is worth reading then something did pass through their head, hopefully a lot, and you have the clues right in front of you; the traces of his thoughts. With a little effort you can become a fly on the wall as the author or screen-writer sits at their desk, ideas passing through their head before being selected and turned into words. Words that are also chosen just as carefully as the ideas they convey and the characters they show you.

Despite only reading a small number of carefully selected books a year — chosen to aid my study, but also to entertain — I do sometimes, much to my frustration, come across one that is badly written. But I try to finish it because it is an opportunity to understand what made the book bad and to explore how it could have been written better.

And it is the same with movies. As much as I love the cinema, I prefer to watch at home where I can pause, rewind, watch again, think…and then conclusion reached, allow the movie to continue at the standard pace till something else captures me. Getting a movie wrong is easier, I feel. There is less room for error; less space to redeem one’s mistakes. But I watch good movies over again, until watching stops being productive to my learning.

So my reviews, as I have said, are studies of the DNA of a story. Often my reviews don’t contain much in the way of spoilers, because I am not focused on telling you what the story is about, I am focused on telling you how it was told.


Image credit: hjl on Flickr. Creative Commons Licence.

Review: The High Druid’s Blade by Terry Brooks

An attractive cover, even if it's a little unoriginal

An attractive cover, even if it’s a little unoriginal

Contains spoilers.

I feel relieved for the prisoners in the UK who are no longer allowed books, because no matter their crime, the torturing of men is just plain wrong. I took this punishment of my own free will.

This book is the worst book I have read in at least a decade. And it is by far the worst book I have read by Terry Brooks, and I have read every single one of his works. His last couple of books have been on a downward trend in my mind, but this one here is particularly shocking.

Simple Plot
Basically, there is no real story. At least not to the standard that there normally is in a book by Terry Brooks.

Terry is pretty good at coming up with new stories; or at least, good variations of the same sort of story. His Shannara series has been going for more than 30 years, with around a book a year over that period. They’ve all been worth reading. But basically, in this book the story is:
Bad guy wants the magic sword the good guy has, so that he can do bad things with it…even though it would be much easier to do those bad things via means already in his disposal!
That’s it. This is very odd for a Terry Brooks book. He usually comes up with something much, much, better than this.

Wooden, emotionless characters
I found the main character, Paxon Leah, boring. He is brave, if foolish. And he is good. Apart from that, I can’t really think of anything worth saying about him and these two things are pretty common (and dull) character traits in this genre. There was nothing about him that singled him out and made me care about him, like him, or want to read more about him.

One of the other characters has a fight with her father. A serious, physical fight. In the aftermath she just rationally explains why it happened without any hint of emotion. Very believable that.

Endless Cliché
At the story’s beginning, great pains are taken to tell us that although the family used to have magic in their blood, these two siblings don’t and it hasn’t been in the family for a couple of generations. So guess what happens near the end of the story? You won’t guess it…It turns out that the girl in the story…wait for it…she DOES have magic in her blood, after all! What a shocker.

But there’s more! The girl has been left in a vegetative state by some magic induced emotional trauma where she is made to believe that she’s been physically tortured till her body is a wreck, when in fact it’s all her head. This is a just a lie in her mind. So how does the writer fix this? Well, handily, the author – Terry Brooks – first ever book in this series was the best selling, “Sword of Shannara,” way back in 1977. And the Sword of Shannara, as fans will recall is the sword of truth. That’s what it does, it exposes the truth of a situation. So of course, the obvious thing that will come to Terry’s mind is to use the sword, which handily, if I recall correctly, is sitting in the same castle as the girl, just waiting to be taken up and put to good use because it is the Sword of Shannara that is the High Druid’s blade. It’s certainly not the Sword of Leah, so what on earth is the book title about because the High Druid’s blade doesn’t even make an appearance!

Instead, the writer of this book goes with a nondescript “magic potion”. Yep, that’s right. Some coloured water!

The dim-witted guard lets them in
Yes, the writer needed to get the protagonist into the baddies lair (for the THIRD time in the same book, no less) and this time, despite the obvious fact the baddie has told the guards not to let anyone in, the guard does. Sorry about that boss, I must be a one dimensional, stereotypical bouncer. Hardly my fault I was written this way…

What’s that behind you?
Yes, even this trick is used, the writer even writes that it was an old trick, blah blah blah. Oh, it’s so dull!

The love interest turns out to be the antagonist’s daughter!!! Shock…
Wow, I didn’t see that coming. Someone should make such clever ideas, illegal. No, really, they should.

Out of character reactions
“What? The character wouldn’t do that,” I found myself saying over and over. The book is littered with them. Either the writer has failed to paint their character correctly in the first place, or more likely it’s just bad story telling. They need said character to do X to fit the plot and they have been too lazy to think of a more believable way to bring that about.

Everyone has the same vocabulary
Just picking out one example here, the word precipitously is used by two characters within the space of a few pages, to describe the same circumstances but with the first instance out of earshot of the other character. It’s almost as if the dialogue was written by a single person, taking no care to carve out individual character dialogues. Hummm…

Price
306 pages for £20. That’s more than 6.5p a page. You have to write a pretty good book if you want to justify a cost like that.
There is a section of the book where what happens is completely isolated from the main story. It’s completely pointless and bizarre. It’s like a crap short story placed in the middle. And yes, the mini plot is completely predictable, too. It looks to me that the writer added this in order to flesh out the story, else the book would have been 200-250 pages instead. This just leaves me feeling taken advantage of. When I write, what I put in a book is relevant to the overall story. Apart from this being ‘training’ for the protagonist, it’s got no other relevance to the story.

I started collecting Terry Brooks work when I was a child. I now have all of his books including mint, unread first editions from before I was born. I have everything he has ever written and I’ve read them all. But this latest offering was so bad that I’m not going to find a space for it on my bookshelf. As a fan, I feel very let down and this will go on ebay with a 99p start.

The bad guy is let go
What happens to the bad guy?
The main protagonist just lets him go. He lets him go even though he kidnapped his sister (twice), striped her naked and chained her to a bed, tortured her, tried to manipulate her into becoming a murderer, tried to steal to kill the protagonist and steal his sword, murdered the protagonist’s friend and mentor and (by proxy) attempted to assassinate his leader and employer…
And he lets him go because he says he’ll trade his freedom for the potion to make his sister well. Okay, but why not either just say no, you’ll give me the potion anyway or I’ll kill you, or say Okay, but then go back on his word because frankly the evil son of a bitch hasn’t exactly earned himself a lot of good will? It’s totally unrealistic and again it highlights how weak the two main characters are.

If I were the writer then I would not have created such a weak bad guy in the first place, but having done so I still can’t understand why the writer didn’t kill him off. Two out of the three times in the book that he faces tough opposition, he runs. But apparently, the writer of this book believes he’s worth keeping around in case there’s a sequel. Well, I wont be wasting my time reading it. This brings a close to a reading, and collecting, of Terry Brooks books, that has lasted since I was a child.

Although it get’s pretty good average ratings on Goodreads I think this is probably down to a lot of fans being blindly loyal and not wanting to tell it how it really is. Or maybe I have just grown up and they haven’t? But I’m certainly not the only person to be disappointed as this sample of reviews from Goodreads show:

“I can’t believe that this is a Terry Brooks novel… It almost feels like someone ghost wrote this book.” Read Jacques‘s full review here. Interesting thought. It could be. I wrote about ghost-writing in an earlier post.

“The lack of urgency isn’t the only problem. Things are also too easy.” Read Lighthearted’s full review here.

“…this particular book (like the last 3 novels) is poor in comparison to earlier stuff. I’ve read everything, so I have good reason to be bleating on about this.” Read Stephen’s full review here.

“I found plot boring and predictable. Everything happened too easily, which I could have easily forgiven if the characters were not so flat and uninteresting. The writing style got repetitive…” Read Fury’s Cane’s full review here.

To quote a few words from the very last page of this book, “There will almost certainly be disappointments and deceptions in your life with us.”

No shit!
Another disappointed fan.

1/10 stars.

Sand by Hugh Howey: book review

sand

No major spoilers.

I am highly selective of what I read. As a writer I don’t want to fill my brain with the echoes of badly-written words, and as a reader who reads for enjoyment, I don’t want to invest precious time reading anything other than the best.

This means that when I find a good thing, I stick to it. Having read the Wool trilogy, a master-class in world-building and plot unveiling, it was a safe bet that Hugh Howey’s follow-up, Sand, would be decent.
The concept of Sand is uniquely original, a real achievement that demonstrates that Hugh Howey is not a one hit wonder and has compelling ideas outside of the silo encompassed universe of Wool. It’s also well-written, and has been well-edited.

Why then am I left disheartened?

The writing style of Sand is grittier (sorry) than in the Wool trilogy – the odd swear word, sexual themes, the dialogue and actions more graphic and abrasive – and this makes the world seem more raw and unforgiving. It is not a bad thing, but it’s a noticeable change in style. There is plenty of exposition, but not enough of it is meaningful; I don’t understand why Howey felt the need to explain this world’s methods of contraception – graphically – while far more important questions go unanswered.

The foundation of a good book seem to be present, but as those important questions go unanswered, you realise the problem is with the chosen story itself and how it is told. It’s core stuff without which your belief in this new universe falls through the gaps, just like the sand.

The Wool trilogy benefited from a clear origin linked to the real world and this helped the reader feel connected, whereas in Sand I didn’t quite experience that same attachment and so the world feels less authentic. Remnants of our own world are briefly shown, enough hints to make it clear they are linked, but they exist separate like the seabed and the ocean surface; connected by water, but miles apart. I find myself wishing for a chain and anchor to connect them more certainly; a vivid demonstration of kinship between the two.

The story didn’t have the same tension that Wool delivered either. The only real tension was provided early on in the story, the claustrophobia, danger, and panic of the sand diving vivid, but the early suggestion of more, did not materialize. Significant dangers are hinted at, but these didn’t manifest into a tangible villain to be feared. All you get are a couple of very one-dimensional baddies who play only a small bit part, and without a strong enemy, the protagonist’s only struggle is against the sand itself, and this is not enough to make compelling reading.

There are differences in structure too. In Wool you stick with a character for long periods, get to live in their skin. In Sand, you follow five or six different characters, members of the same family, for briefer periods, usually just one or two short chapters at a time, and I felt this made it harder for Howey to carve out a uniqueness to each character, and for the reader to make a connection with them.

You get near the end and you think, okay, there has to be a book worth of writing left to take this to the next level, expanding on the universe, explaining the details, settling into one or two of the characters and developing them more fully, seeing this ‘No Mans Land’ that is oft talked about where the sand comes from…this is heading for a sequel and maybe I just need a little more patience…but no. He just ends it without showing you any of that, it’s a bit like he found those questions too hard to figure out answers for, or just lost interest in the story himself.

So, would I recommend it? Perhaps, but only if you don’t have something better to read. Like Wool; if you haven’t read that yet, then go read that instead, it is far superior.

6/10

Picture by Rene Jakobson. CC licence use.